Voice of Truth

Comes in six flavors: up, down, charm, strange, top, and bottom. Cones and cups available.

TTAGGG 16 December 2009

Filed under: Uncategorized — Aly @ 6:03 pm

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

What you see here is fifty repeats of the sequence TTAGGG. The absence of this sequence in some part of my body will likely kill me one day. (more…)

 

This Is Why Biology Is Great 16 December 2009

Filed under: Uncategorized — Aly @ 4:10 am

I think it’s really, amazingly awesome that cellular respiration and photosynthesis undo each other. It’s something I take for granted most of the year, but when it comes time to study the concepts for the test, I begin to marvel at the symmetry of it all.

I love those epiphanies you get when something finally clicks. I re-experience that epiphany every time I look at cellular respiration and photosynthesis again. I re-examine the electron transport chains, the Krebs cycle and Calvin cycle, and glycolysis and the formation of glucose. I gasp again as it all sinks in.

Just wanted to register that awe.

 

UF Winter Results 7 December 2009

Filed under: Uncategorized — Aly @ 7:37 pm

We won. :) Varsity team (team A) was undefeated and won first place in division I (first time ever for PHS). JV team (team B) was undefeated and won first place in division II. Team C was composed of juniors, but division I was full so we had to put them in division II with the assumption that they couldn’t win anything since division II is supposed to be for underclassmen only. They were second place, but the way things worked out, the people running everything just decided to drop them a place. They won third. Phi, Hayden, and Freddie all won individual trophies in division II.

Here are our scores for each of the games we played.

Preliminaries

  1. us (380) vs. Montverde (90)
  2. us (300) vs. Lincoln A (200)
  3. us (365) vs. Rickards B (10)
  4. us (455) vs. Hardee B (10)
  5. us (415) vs. Maclay (10)
  6. us (300) vs. Western (110)
  7. us (280) vs. Tate (150)

Play-offs

  1. us (340) vs. Eastside B (30)
  2. us (305) vs. Ransom-Everglades (35)
  3. us (275) vs. Eastside A (90)

Damn, we are so cool.

 

 
Follow

Get every new post delivered to your Inbox.