Voice of Truth

Comes in six flavors: up, down, charm, strange, top, and bottom. Cones and cups available.

TTAGGG 16 December 2009

Filed under: Uncategorized — Aly @ 6:03 pm

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

What you see here is fifty repeats of the sequence TTAGGG. The absence of this sequence in some part of my body will likely kill me one day.

TTAGGG. It’s the sequence found in human telomeres. With rapid improvement of quality of life in the past, say, one hundred years, more and more people are dying of “old age”. What is old age? The term encompasses many things. The body begins to deteriorate as old cells, tissues, organs, etc., don’t function as well. And why do they function poorly? One cause is damage to DNA.

Carcinogens such as UV radiation, cigarette smoke, radioactive substances, X-rays, etc., all cause DNA mutations. Errors in DNA replication are usually neutral, sometimes bad, but rarely good. When mutations occur in certain genes that affect cell division, proto-oncogenes, cancer can result.

Cancer can also result if the telomeres are gone. Telomeres are long strings of DNA that cap each end of a chromosome. In DNA replication, the first few nucleotides are often ignored, meaning the chromosome grows slightly shorter after each replication. Eventually, if the telomeres run out, valuable parts of genes could be left out.

Dolly, the first cloned mammal, died early because the telomeres on her DNA were shorter than normal — they were taken from her mother/sister/whatever’s cells. Her mother/sister/whatever’s telomeres are short, due to her age.

Most people alive today will endure some sort of age-related disease. Our medical capabilities have progressed far enough to ensure that much. So, chances are, you may miss some TTAGGG by the end, too.

Advertisement
 

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Connecting to %s

 
Follow

Get every new post delivered to your Inbox.