<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	xmlns:georss="http://www.georss.org/georss" xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#" xmlns:media="http://search.yahoo.com/mrss/"
	>

<channel>
	<title>Voice of Truth</title>
	<atom:link href="http://alitheiapsis.wordpress.com/feed/" rel="self" type="application/rss+xml" />
	<link>http://alitheiapsis.wordpress.com</link>
	<description>Comes in six flavors: up, down, charm, strange, top, and bottom. Cones and cups available.</description>
	<lastBuildDate>Sun, 08 Aug 2010 05:36:54 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.com/</generator>
<cloud domain='alitheiapsis.wordpress.com' port='80' path='/?rsscloud=notify' registerProcedure='' protocol='http-post' />
<image>
		<url>http://s2.wp.com/i/buttonw-com.png</url>
		<title>Voice of Truth</title>
		<link>http://alitheiapsis.wordpress.com</link>
	</image>
	<atom:link rel="search" type="application/opensearchdescription+xml" href="http://alitheiapsis.wordpress.com/osd.xml" title="Voice of Truth" />
	<atom:link rel='hub' href='http://alitheiapsis.wordpress.com/?pushpress=hub'/>
		<item>
		<title>Holy Shit, Am I Blagging Again?</title>
		<link>http://alitheiapsis.wordpress.com/2010/08/08/holy-shit-am-i-blagging-again/</link>
		<comments>http://alitheiapsis.wordpress.com/2010/08/08/holy-shit-am-i-blagging-again/#comments</comments>
		<pubDate>Sun, 08 Aug 2010 05:36:54 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=772</guid>
		<description><![CDATA[&#8230;maybe. Haha. Yeah, it&#8217;s been over six months. I would be lying if I claimed I&#8217;ve been too busy to blog since then; that&#8217;s just ridiculous. Yes, the end of the year got really stressful, and then the next day I was in France for two and a half weeks, but I&#8217;ve had plenty of [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=772&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>&#8230;maybe. Haha. Yeah, it&#8217;s been over six months. I would be lying if I claimed I&#8217;ve been too busy to blog since then; that&#8217;s just ridiculous. Yes, the end of the year got really stressful, and then the next day I was in France for two and a half weeks, but I&#8217;ve had plenty of time. The only problem is, I&#8217;ve had nothing to say.</p>
<p>That sounds like such a cop-out, but it&#8217;s unfortunately true. I&#8217;ll just have to get over myself and write again, won&#8217;t I? Haha.</p>
<p>So anyway, the biggest thing going on in my life right now is probably college applications and getting pressured by my parents to choose a major. I visited six colleges in the past month: UF, Johns Hopkins, Georgetown, UPenn, Princeton, and UMich. Sounds impressive, except it has clarified just about nothing for me. The problem lies in that I have no clue what I want to major in. I have no clue what I want to have as a career. And since most schools have certain areas in which they are particularly strong, knowing a major would make this process only about a million times easier. Oh well. I&#8217;ll just apply to everywhere now and figure it out when they let me in/offer financial aid.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/772/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/772/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/772/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/772/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/772/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/772/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/772/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/772/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=772&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2010/08/08/holy-shit-am-i-blagging-again/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>New Semester Resolutions!</title>
		<link>http://alitheiapsis.wordpress.com/2010/01/21/new-semester-resolutions/</link>
		<comments>http://alitheiapsis.wordpress.com/2010/01/21/new-semester-resolutions/#comments</comments>
		<pubDate>Thu, 21 Jan 2010 07:22:04 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=768</guid>
		<description><![CDATA[I&#8217;m a terrible person: I haven&#8217;t updated in a good two weeks. :( But exams are over and the new semester has begun. After experiencing my first day of the second half of junior year, I realized some shit needs to change. First, I need to get a better sleep schedule. My current one is [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=768&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>I&#8217;m a terrible person: I haven&#8217;t updated in a good two weeks. :( But exams are over and the new semester has begun. After experiencing my first day of the second half of junior year, I realized some shit needs to change.</p>
<p>First, I need to get a better sleep schedule. My current one is pathetic and I would actually rather not talk about it.</p>
<p>Second, I need to dedicate an hour to reading (recreational or required) <em>away</em> from the computer. While this would preferably occur at the end of the day, that may not be possible. I am currently a hundred pages into <em>In Cold Blood</em> and have been assigned <em>Madame Bovary</em> for English class. In addition, I need to keep up with the reading for my other classes.</p>
<p>Third, I need to exercise at least 15 minutes every day. I plan to use this time to study by reading while using the treadmill.</p>
<p>Fourth, I gotta get all my bio labs done on time! It&#8217;s a running joke, and I would kind of like it to end. Like, now.</p>
<p>This list is really impromptu and probably stupid. But I just wanted to have something <em>up</em>.</p>
<p>&#8212;</p>
<p>Friday we&#8217;re going to Spartanburg, SC, for a tournament. It&#8217;s one of the biggest tournaments we ever go to (except for nationals). ISome of the best schools in the Southeast will be there. I don&#8217;t really think there&#8217;s a chance of us winning, but I think we can come close.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/768/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/768/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/768/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/768/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/768/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/768/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/768/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/768/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=768&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2010/01/21/new-semester-resolutions/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>Sandra&#8217;s Blag</title>
		<link>http://alitheiapsis.wordpress.com/2010/01/04/sandras-blag/</link>
		<comments>http://alitheiapsis.wordpress.com/2010/01/04/sandras-blag/#comments</comments>
		<pubDate>Mon, 04 Jan 2010 22:07:38 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=761</guid>
		<description><![CDATA[My friend Sandra has a blag! Ch-ch-ch-check it: Reason of Treason. Cool stuff, cool stuff. :)<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=761&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>My friend Sandra has a blag! Ch-ch-ch-check it: <a href="http://reasonoftreason.tumblr.com/">Reason of Treason</a>. Cool stuff, cool stuff. :)</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/761/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/761/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/761/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/761/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/761/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/761/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/761/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/761/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=761&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2010/01/04/sandras-blag/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>Memoirs</title>
		<link>http://alitheiapsis.wordpress.com/2010/01/02/memoirs/</link>
		<comments>http://alitheiapsis.wordpress.com/2010/01/02/memoirs/#comments</comments>
		<pubDate>Sun, 03 Jan 2010 02:17:17 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=720</guid>
		<description><![CDATA[I always dreamt that whatever I did, I would write a book of some kind. Whether just a memoir or a real work of art, I always believed I&#8217;d write (assuming, of course, I do something worth writing about). I just assumed it. I wonder, though, what worth memoirs really have. Anyone can write a [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=720&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>I always dreamt that whatever I did, I would write a book of some kind. Whether just a memoir or a real work of art, I always believed I&#8217;d write (assuming, of course, I do something worth writing about). I just assumed it.</p>
<p>I wonder, though, what worth memoirs really have. Anyone can write a memoir nowadays. Take, for example,<em> Time Magazine </em>columnist Joel Stein&#8217;s <a title="Joel Stein on Writing a Memoir Quickly like Sarah Palin" href="http://www.time.com/time/magazine/article/0,9171,1929217,00.html">parody</a> of Sarah Palin&#8217;s book: <em>Going Rogue</em> (oh and, Joel Stein is my all-time favorite <em>Time</em> writer. His column is called The Awesome Column. What&#8217;s not to love?). There are people, like the one featured in the article, who make their living on writing about other people&#8217;s lives. People pump out the memoirs like crazy.</p>
<p>I wonder at people&#8217;s motivations for writing memoirs. Is it narcissism? I am not speaking of those whose memoirs are legitimately interesting, of historical significance, or written with a specific purpose in mind. I am nevertheless sure that most memoirs out there aren&#8217;t really that memorable.</p>
<p>It seems I&#8217;m being disdainful, but I legitimately wonder what role a memoir can serve. Perhaps a touching story may inspire someone. I know many politicians write memoirs for the publicity and name recognition. I see no other reason why famous people get to write books about themselves when I already feel like I know too much about their lives.</p>
<p>I propose, then, that almost all memoirs are worthless, since they seem not to serve a purpose other than boosting the ego of the &#8220;author&#8221; (because we all know ghostwriters do the actual writing).</p>
<p>Yes? No? Am I too harsh?</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/720/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/720/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/720/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/720/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/720/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/720/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/720/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/720/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=720&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2010/01/02/memoirs/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>Lost Books</title>
		<link>http://alitheiapsis.wordpress.com/2010/01/01/lost-books/</link>
		<comments>http://alitheiapsis.wordpress.com/2010/01/01/lost-books/#comments</comments>
		<pubDate>Fri, 01 Jan 2010 08:03:11 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=755</guid>
		<description><![CDATA[Over the years, I have lost quite a few books. By &#8220;lost&#8221;, I mean misplaced or forgotten or just disappeared. I begin my sad account with the tale of my lost Roald Dahl books (Diligent readers may recall &#8212; I almost didn&#8217;t &#8212; that I wrote a post mentioning Roald Dahl last year). I remember [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=755&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>Over the years, I have lost quite a few books. By &#8220;lost&#8221;, I mean misplaced or forgotten or just disappeared.</p>
<p>I begin my sad account with the tale of my lost Roald Dahl books (Diligent readers may recall &#8212; I almost didn&#8217;t &#8212; that I wrote <a href="http://alitheiapsis.wordpress.com/2008/12/15/charlie-and-the-chocolate-factory/">a post</a> mentioning Roald Dahl last year). I remember owning <em>The Witches</em>; <em>Danny, the Champion of the World</em>;<em> The Wonderful Story of Henry Sugar and Six More</em>; <em>Esio Trot</em>; and <em>Fantastic Mr. Fox</em> (which has been turned into a movie I will refuse to watch). I read all of Dahl&#8217;s children&#8217;s stories &#8212; except perhaps one. I loved them dearly. Yet, I realized one day that I no longer had them. Quel horreur! I was convinced they were hidden away in some corner of the attic (I find this idea of old, cherished artifacts being kept away in an attic very romantic), but it was not so. As I mentioned in that previous post, Rald Dahl&#8217;s stories are definitely going to be something my children read.</p>
<p>(I have been saying that a lot &#8212; when I have children they will definitely read that or watch this. On the list so far: the Harry Potter series, all the works of Dr. Seuss, <em>Scooby Doo</em>, Disney animated movies, everything by Pixar&#8230;)<span id="more-755"></span></p>
<p>Another unfortunate loss: I used to have not <em>one</em>, but <em>two</em> copies of <em>Little Women</em>. Well, one included only the first half, but it was ok because it was one of those two-books-in-one, and the other book was the fairly decent <em>The Secret Garden</em>. The <em>Little Women</em> story is truly a classic and it saddens me that I don&#8217;t have it any longer. I started off with reading the little Children&#8217;s Illustrated Classics abridged version, so you know the story has been with me for a long time. I still enjoy watching the movie when it comes on. Once, in second grade, we were doing a reading program in which you were quizzed on books, and if you passed you got a certain number of points. I took the <em>Little Women</em> test for my friend because he was short on points. I still remember those days. :) (I won the accelerated reading contest in fourth grade, and the prize was pie-ing my principal in the face! Good times, good times.)</p>
<p>There was a time when I was perhaps <em>too</em> obsessed with Harry Potter (impossible!, you say? My parents beg to differ). I used to hide away my copies under my bed and read them in secret. At some point, however, I realized I couldn&#8217;t find my copy of the third book (<em>Prisoner of Azkaban</em>, for you lame-os who don&#8217;t know them by number) <em>anywhere</em>. I searched and I searched, for weeks and weeks. I was convinced that my mother had hidden it away (she had done it in the past, but never so effectively). Years went by. Two years, to be exact. Because I never knew what happened to my book until I went to India (which we try to do once every two years) and found out that I had left my copy there!</p>
<p>I seem to have misplaced my copy of <em>Heart of Darkness</em>. I had started to read it, but never really got into it. Now, for the life of me, I can&#8217;t find it! Damn.</p>
<p>I almost included <em>Brave New World</em> on this list, because when I was organizing my bookshelf the other day I had no idea where it went. I recall, however, that I lent it out to someone several months ago (it&#8217;s been at least five or six months) and they haven&#8217;t returned it yet. :(</p>
<p>Another that almost made the list: <em>Eragon</em>. It, too, is on a long-term loan. Except, this loan has lasted at least two or three years. Yeah&#8230;</p>
<p>I had lost <em>The Scarlet Letter</em> for quite a while, but Hayden found it somehow and remembered that I had lost my copy. Weird. Still haven&#8217;t had a chance to read it, though.</p>
<p>&#8212;</p>
<p>I hope this long, rambling post makes up for the scarcity of posts these past few weeks. I have an excuse, though! I was in Orlando for five days. (Not really a great excuse for the remaining 12-ish days worth of no posts, but whatever.)</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/755/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/755/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/755/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/755/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/755/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/755/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/755/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/755/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=755&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2010/01/01/lost-books/feed/</wfw:commentRss>
		<slash:comments>2</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>TTAGGG</title>
		<link>http://alitheiapsis.wordpress.com/2009/12/16/ttaggg/</link>
		<comments>http://alitheiapsis.wordpress.com/2009/12/16/ttaggg/#comments</comments>
		<pubDate>Wed, 16 Dec 2009 23:03:31 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=749</guid>
		<description><![CDATA[TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG What you see here is fifty repeats of the sequence TTAGGG. The absence of this sequence in some part of my body will likely kill me one day. TTAGGG. It&#8217;s the sequence found in human telomeres. With rapid improvement of quality of life in the past, say, one hundred years, [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=749&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG</p>
<p>What you see here is fifty repeats of the sequence TTAGGG. The absence of this sequence in some part of my body will likely kill me one day. <span id="more-749"></span></p>
<p>TTAGGG. It&#8217;s the sequence found in human telomeres. With rapid improvement of quality of life in the past, say, one hundred years, more and more people are dying of &#8220;old age&#8221;. What is old age? The term encompasses many things. The body begins to deteriorate as old cells, tissues, organs, etc., don&#8217;t function as well. And why do they function poorly? One cause is damage to DNA.</p>
<p>Carcinogens such as UV radiation, cigarette smoke, radioactive substances, X-rays, etc., all cause DNA mutations. Errors in DNA replication are usually neutral, sometimes bad, but rarely good. When mutations occur in certain genes that affect cell division, proto-oncogenes, cancer can result.</p>
<p>Cancer can also result if the telomeres are gone. Telomeres are long strings of DNA that cap each end of a chromosome. In DNA replication, the first few nucleotides are often ignored, meaning the chromosome grows slightly shorter after each replication. Eventually, if the telomeres run out, valuable parts of genes could be left out.</p>
<p>Dolly, the first cloned mammal, died early because the telomeres on her DNA were shorter than normal &#8212; they were taken from her mother/sister/whatever&#8217;s cells. Her mother/sister/whatever&#8217;s telomeres are short, due to her age.</p>
<p>Most people alive today will endure some sort of age-related disease. Our medical capabilities have progressed far enough to ensure that much. So, chances are, you may miss some TTAGGG by the end, too.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/749/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/749/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/749/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/749/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/749/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/749/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/749/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/749/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=749&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2009/12/16/ttaggg/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>This Is Why Biology Is Great</title>
		<link>http://alitheiapsis.wordpress.com/2009/12/16/this-is-why-biology-is-great/</link>
		<comments>http://alitheiapsis.wordpress.com/2009/12/16/this-is-why-biology-is-great/#comments</comments>
		<pubDate>Wed, 16 Dec 2009 09:10:57 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=746</guid>
		<description><![CDATA[I think it&#8217;s really, amazingly awesome that cellular respiration and photosynthesis undo each other. It&#8217;s something I take for granted most of the year, but when it comes time to study the concepts for the test, I begin to marvel at the symmetry of it all. I love those epiphanies you get when something finally [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=746&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>I think it&#8217;s really, amazingly awesome that cellular respiration and photosynthesis undo each other. It&#8217;s something I take for granted most of the year, but when it comes time to study the concepts for the test, I begin to marvel at the symmetry of it all.</p>
<p>I love those epiphanies you get when something finally clicks. I re-experience that epiphany every time I look at cellular respiration and photosynthesis again. I re-examine the electron transport chains, the Krebs cycle and Calvin cycle, and glycolysis and the formation of glucose. I gasp again as it all sinks in.</p>
<p>Just wanted to register that awe.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/746/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/746/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/746/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/746/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/746/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/746/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/746/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/746/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=746&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2009/12/16/this-is-why-biology-is-great/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>UF Winter Results</title>
		<link>http://alitheiapsis.wordpress.com/2009/12/07/uf-winter-results/</link>
		<comments>http://alitheiapsis.wordpress.com/2009/12/07/uf-winter-results/#comments</comments>
		<pubDate>Tue, 08 Dec 2009 00:37:47 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=743</guid>
		<description><![CDATA[We won. :) Varsity team (team A) was undefeated and won first place in division I (first time ever for PHS). JV team (team B) was undefeated and won first place in division II. Team C was composed of juniors, but division I was full so we had to put them in division II with [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=743&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>We won. :) Varsity team (team A) was undefeated and won first place in division I (first time ever for PHS). JV team (team B) was undefeated and won first place in division II. Team C was composed of juniors, but division I was full so we had to put them in division II with the assumption that they couldn&#8217;t win anything since division II is supposed to be for underclassmen only. They were second place, but the way things worked out, the people running everything just decided to drop them a place. They won third. Phi, Hayden, and Freddie all won individual trophies in division II.</p>
<p>Here are our scores for each of the games we played.</p>
<p><strong>Preliminaries</strong></p>
<ol>
<li>us (380) vs. Montverde (90)</li>
<li>us (300) vs. Lincoln A (200)</li>
<li>us (365) vs. Rickards B (10)</li>
<li>us (455) vs. Hardee B (10)</li>
<li>us (415) vs. Maclay (10)</li>
<li>us (300) vs. Western (110)</li>
<li>us (280) vs. Tate (150)</li>
</ol>
<p><strong>Play-offs</strong></p>
<ol>
<li>us (340) vs. Eastside B (30)</li>
<li>us (305) vs. Ransom-Everglades (35)</li>
<li>us (275) vs. Eastside A (90)</li>
</ol>
<p>Damn, we are so cool.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/743/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/743/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/743/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/743/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/743/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/743/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/743/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/743/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=743&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2009/12/07/uf-winter-results/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>First Impressions of Google Wave</title>
		<link>http://alitheiapsis.wordpress.com/2009/11/27/first-impressions-of-google-wave/</link>
		<comments>http://alitheiapsis.wordpress.com/2009/11/27/first-impressions-of-google-wave/#comments</comments>
		<pubDate>Sat, 28 Nov 2009 01:14:35 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=737</guid>
		<description><![CDATA[So I got invited to Google Wave today. Cool stuff, right? Several of my friends are on there, so we ended up having a little conversation, kind of like a chatroom. I&#8217;m not satisfied. First, I should clarify: I don&#8217;t think we were using Wave for the right purposes. Wave is supposed to be for [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=737&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>So I got invited to Google Wave today. Cool stuff, right?</p>
<p>Several of my friends are on there, so we ended up having a little conversation, kind of like a chatroom. I&#8217;m not satisfied. First, I should clarify: I don&#8217;t think we were using Wave for the right purposes. Wave is supposed to be for collaboration or whatever. We were just a bunch of sixteen-year-olds goofing off. Also, this post presumes a cursory familiarity with Google Wave (see the <a href="http://www.google.com/support/wave/bin/topic.py?hl=en&amp;topic=24975">Google Wave Help Page</a> for info). In any case, here are my thoughts.</p>
<p><strong>The positives. </strong>I can see using Wave (when it comes out of beta or whatever you call this) for newspaper stuff. It looks useful for things like invitations (but Facebook takes care of a lot of that, doesn&#8217;t it?). It&#8217;s definitely a cool concept.</p>
<p><strong>The negatives.</strong> The see-what-your-friends-are-typing-IN-REAL-TIME is useful, but confusing. Actually, I prefer the way <a title="EtherPad" href="http://etherpad.com/">EtherPad</a> does things. It&#8217;s more intuitive. The main issue I see is that the lag makes &#8220;real time&#8221; rather inaccurate. The annoyance comes in because the words lag showing up on your own screen as well as everyone else&#8217;s. So it feels like typing on my computer when it&#8217;s feeling especially slow ;). Another annoyance is the lack of a &#8220;mark all as read&#8221;-type feature. You have to click on each reply before Wave considers it &#8220;read&#8221;.</p>
<p>Julie said it seemed as though Wave was trying to improve communication&#8230;but failing. I kind of agree, but at the same time I think it could be really useful in the right circumstances.</p>
<p>My last concern is that all of the legitimate uses I can think of for Google Wave are rendered moot because barely any of my friends are on here :-/.</p>
<p>In any case, I&#8217;m sure Wave will be improved substantially before it makes it out of preview mode. And it has the potential to be <em>awesome</em>.</p>
<p>Edit: also I think the whole &#8220;\/\/ave&#8221; thing is a little ridiculous. It&#8217;s a wave, we get it. Just use a regular W from now on.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/737/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/737/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/737/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/737/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/737/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/737/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/737/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/737/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=737&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2009/11/27/first-impressions-of-google-wave/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
		<item>
		<title>An Adventure!</title>
		<link>http://alitheiapsis.wordpress.com/2009/11/18/an-adventure/</link>
		<comments>http://alitheiapsis.wordpress.com/2009/11/18/an-adventure/#comments</comments>
		<pubDate>Wed, 18 Nov 2009 06:30:20 +0000</pubDate>
		<dc:creator>Aly</dc:creator>
				<category><![CDATA[Uncategorized]]></category>

		<guid isPermaLink="false">http://alitheiapsis.wordpress.com/?p=734</guid>
		<description><![CDATA[I rode the bus yesterday. It was my first time riding the bus home since middle school, and what an experience it was. I&#8217;ll refer to the notebook for my account of the event. [I originally wrote this in the notebook in cobbled-together French, of which I'm pretty proud.] I had to take the bus [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=734&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>I rode the bus yesterday. It was my first time riding the bus home since middle school, and what an experience it was. I&#8217;ll refer to the notebook for my account of the event. [I originally wrote this in the notebook in cobbled-together French, of which I'm pretty proud.]</p>
<p>I had to take the bus because my dad&#8217;s out of town and my mom had work. I called up Kaylynn a couple days before and we decided where we were going to meet up. I&#8217;ve ridden the bus to school in the past, when we have a late-start day and my mom has work, so I was somewhat acquainted with the institution. <span id="more-734"></span></p>
<p>On that fateful day, I hurried to our rendez-vous point (strangely enough, I did not use that term when I wrote it in French :)) and waited worriedly. Then, Kaylynn and I set off to the bus gathering area place. We got on the bus without a hitch, though I do admit that those seats were rather cramped.</p>
<p>The bus ride was rather uneventful. The excitement came as we got off at the bus stop. I had pointed this out as we walked out to the buses, but it hit me again &#8212; everything was lovely. That morning, it had been very foggy (it had cleared up around 8:30, as I drove to school after getting my vaccination. Around that time, it was completely lovely. The light was just amazing). Things were just as pretty at 4 PM.</p>
<p>The bus stop, by a happy coincidence, is a short walk away from my neighborhood. It&#8217;s a little sketchy walking home, especially when you feel the awkwardity (I use this &#8220;word&#8221; because it has a great, awkward feel to its pronunciation) of people looking at you as they drive by. Also, there are no sidewalks.</p>
<p>The loveliness of the day made up for it, though. The sun was hitting everything at the right angle, and it felt as though I was in a Thomas Cole <a href="http://en.wikipedia.org/wiki/File:Cole_Thomas_The_Oxbow_(The_Connecticut_River_near_Northampton_1836.jpg">painting</a>. I thoroughly enjoyed my walk home. I also thoroughly enjoyed my five hours of partaying before my mom got home (partaying is a relative term).</p>
<p>The best part? I get to do it all again tomorrow!</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/alitheiapsis.wordpress.com/734/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/alitheiapsis.wordpress.com/734/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/alitheiapsis.wordpress.com/734/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/alitheiapsis.wordpress.com/734/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/alitheiapsis.wordpress.com/734/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/alitheiapsis.wordpress.com/734/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/alitheiapsis.wordpress.com/734/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/alitheiapsis.wordpress.com/734/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=alitheiapsis.wordpress.com&amp;blog=4505216&amp;post=734&amp;subd=alitheiapsis&amp;ref=&amp;feed=1" width="1" height="1" />]]></content:encoded>
			<wfw:commentRss>http://alitheiapsis.wordpress.com/2009/11/18/an-adventure/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
	
		<media:content url="http://0.gravatar.com/avatar/2532e4b422e730f2911aaf47a5015dd2?s=96&#38;d=http%3A%2F%2F0.gravatar.com%2Favatar%2Fad516503a11cd5ca435acc9bb6523536%3Fs%3D96&#38;r=PG" medium="image">
			<media:title type="html">Aly</media:title>
		</media:content>
	</item>
	</channel>
</rss>
