Voice of Truth

Comes in six flavors: up, down, charm, strange, top, and bottom. Cones and cups available.

Holy Shit, Am I Blagging Again? 8 August 2010

Filed under: Uncategorized — Aly @ 12:36 am

…maybe. Haha. Yeah, it’s been over six months. I would be lying if I claimed I’ve been too busy to blog since then; that’s just ridiculous. Yes, the end of the year got really stressful, and then the next day I was in France for two and a half weeks, but I’ve had plenty of time. The only problem is, I’ve had nothing to say.

That sounds like such a cop-out, but it’s unfortunately true. I’ll just have to get over myself and write again, won’t I? Haha.

So anyway, the biggest thing going on in my life right now is probably college applications and getting pressured by my parents to choose a major. I visited six colleges in the past month: UF, Johns Hopkins, Georgetown, UPenn, Princeton, and UMich. Sounds impressive, except it has clarified just about nothing for me. The problem lies in that I have no clue what I want to major in. I have no clue what I want to have as a career. And since most schools have certain areas in which they are particularly strong, knowing a major would make this process only about a million times easier. Oh well. I’ll just apply to everywhere now and figure it out when they let me in/offer financial aid.

 

New Semester Resolutions! 21 January 2010

Filed under: Uncategorized — Aly @ 2:22 am

I’m a terrible person: I haven’t updated in a good two weeks. :( But exams are over and the new semester has begun. After experiencing my first day of the second half of junior year, I realized some shit needs to change.

First, I need to get a better sleep schedule. My current one is pathetic and I would actually rather not talk about it.

Second, I need to dedicate an hour to reading (recreational or required) away from the computer. While this would preferably occur at the end of the day, that may not be possible. I am currently a hundred pages into In Cold Blood and have been assigned Madame Bovary for English class. In addition, I need to keep up with the reading for my other classes.

Third, I need to exercise at least 15 minutes every day. I plan to use this time to study by reading while using the treadmill.

Fourth, I gotta get all my bio labs done on time! It’s a running joke, and I would kind of like it to end. Like, now.

This list is really impromptu and probably stupid. But I just wanted to have something up.

Friday we’re going to Spartanburg, SC, for a tournament. It’s one of the biggest tournaments we ever go to (except for nationals). ISome of the best schools in the Southeast will be there. I don’t really think there’s a chance of us winning, but I think we can come close.

 

Sandra’s Blag 4 January 2010

Filed under: Uncategorized — Aly @ 5:07 pm

My friend Sandra has a blag! Ch-ch-ch-check it: Reason of Treason. Cool stuff, cool stuff. :)

 

Memoirs 2 January 2010

Filed under: Uncategorized — Aly @ 9:17 pm

I always dreamt that whatever I did, I would write a book of some kind. Whether just a memoir or a real work of art, I always believed I’d write (assuming, of course, I do something worth writing about). I just assumed it.

I wonder, though, what worth memoirs really have. Anyone can write a memoir nowadays. Take, for example, Time Magazine columnist Joel Stein’s parody of Sarah Palin’s book: Going Rogue (oh and, Joel Stein is my all-time favorite Time writer. His column is called The Awesome Column. What’s not to love?). There are people, like the one featured in the article, who make their living on writing about other people’s lives. People pump out the memoirs like crazy.

I wonder at people’s motivations for writing memoirs. Is it narcissism? I am not speaking of those whose memoirs are legitimately interesting, of historical significance, or written with a specific purpose in mind. I am nevertheless sure that most memoirs out there aren’t really that memorable.

It seems I’m being disdainful, but I legitimately wonder what role a memoir can serve. Perhaps a touching story may inspire someone. I know many politicians write memoirs for the publicity and name recognition. I see no other reason why famous people get to write books about themselves when I already feel like I know too much about their lives.

I propose, then, that almost all memoirs are worthless, since they seem not to serve a purpose other than boosting the ego of the “author” (because we all know ghostwriters do the actual writing).

Yes? No? Am I too harsh?

 

Lost Books 1 January 2010

Filed under: Uncategorized — Aly @ 3:03 am

Over the years, I have lost quite a few books. By “lost”, I mean misplaced or forgotten or just disappeared.

I begin my sad account with the tale of my lost Roald Dahl books (Diligent readers may recall — I almost didn’t — that I wrote a post mentioning Roald Dahl last year). I remember owning The Witches; Danny, the Champion of the World; The Wonderful Story of Henry Sugar and Six More; Esio Trot; and Fantastic Mr. Fox (which has been turned into a movie I will refuse to watch). I read all of Dahl’s children’s stories — except perhaps one. I loved them dearly. Yet, I realized one day that I no longer had them. Quel horreur! I was convinced they were hidden away in some corner of the attic (I find this idea of old, cherished artifacts being kept away in an attic very romantic), but it was not so. As I mentioned in that previous post, Rald Dahl’s stories are definitely going to be something my children read.

(I have been saying that a lot — when I have children they will definitely read that or watch this. On the list so far: the Harry Potter series, all the works of Dr. Seuss, Scooby Doo, Disney animated movies, everything by Pixar…) (more…)

 

TTAGGG 16 December 2009

Filed under: Uncategorized — Aly @ 6:03 pm

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

What you see here is fifty repeats of the sequence TTAGGG. The absence of this sequence in some part of my body will likely kill me one day. (more…)

 

This Is Why Biology Is Great

Filed under: Uncategorized — Aly @ 4:10 am

I think it’s really, amazingly awesome that cellular respiration and photosynthesis undo each other. It’s something I take for granted most of the year, but when it comes time to study the concepts for the test, I begin to marvel at the symmetry of it all.

I love those epiphanies you get when something finally clicks. I re-experience that epiphany every time I look at cellular respiration and photosynthesis again. I re-examine the electron transport chains, the Krebs cycle and Calvin cycle, and glycolysis and the formation of glucose. I gasp again as it all sinks in.

Just wanted to register that awe.

 

 
Follow

Get every new post delivered to your Inbox.